Selection of indigenous Rhodobacter sp. ability to process organic compounds | Статья в журнале «Молодой ученый»

Отправьте статью сегодня! Журнал выйдет 12 апреля, печатный экземпляр отправим 16 апреля.

Опубликовать статью в журнале

Авторы: ,

Рубрика: Биология

Опубликовано в Молодой учёный №21 (468) май 2023 г.

Дата публикации: 29.05.2023

Статья просмотрена: 15 раз

Библиографическое описание:

Фам, Тхи Ми. Selection of indigenous Rhodobacter sp. ability to process organic compounds / Тхи Ми Фам, Суан Донг Буй. — Текст : непосредственный // Молодой ученый. — 2023. — № 21 (468). — С. 18-25. — URL: https://moluch.ru/archive/468/103293/ (дата обращения: 04.04.2025).



The study isolated purple non-sulfur bacteria from water samples of shrimpfarming at Truong Dinh Village, Hoa Lien Commune, Hoa Vang District, Da Nang City, and Hiep Hai Village, Binh Hung Commune, Thang Binh District, Quang Nam Province. The results showed that one strain of RH02 (Rhodobacter capsulatus) bacteria was isolated and identified. Determining the optimal culture conditions for this strain is the DSMZ — 27 habitat at 28 -30°C, pH = 7, salinity 25‰, and biomass collection time after 72h of culture. The Rhodobacter capsulatus strain processed organic compounds after seven days of testing, with an 80–85 % efficiency.

Keyword: non-sulfur purple bacteria, shrimp farming, waste water, nitrogen, Rhodobacter capsulatus.

1. Introduction

Annually, the shrimp industry contributes about 40–45 % of total seafood export value, equivalent to 3.5–4 billion USD (Research Institute for Aquaculture No.1, 2013). Besides that, Shrimp farms also need more planning in intensive farming, a large amount of excess feed and organic matter released into the environment, and high-density shrimp farming in chemical treatment. These organic compounds stimulate the growth of microorganisms, pollute ponds, and unbalance the ecosystem (Research Institute for Aquaculture No.1, 2013). Research results show that 48.0–87.3 % (N) and 75.0–94.0 % (P) inputs in shrimp ponds are not absorbed to create shrimp biomass but are released into the environment through water change, discharge when harvesting, and deposition in the bottom mud of the pond. Thus, for each ton of shrimp farming, about 16.8–157.2 kg N and 2.3–45.9 kg P will be released into the environment (Luo et al., 2012).

Among the microorganisms involved in the aquarium's carbon, nitrogen, and sulfur cycles, purple non-sulfur bacteria play an important role in improving water quality. Purple non-sulfur bacteria can grow by photoautotrophs, photoheterotrophs, or heterotrophs, depending on light, oxygen, and suitable carbon sources. They can utilize organic matter with or without sunlight, and some species can remove H2S (Kornochalert et al., 2014.

To contribute to exploiting the potential application of indigenous microorganism’s resources, which are abundant for wastewater treatment of shrimp ponds, we selected a strain of indigenous Rhodobacter sp. ability to process organic compounds.

2. Research methods

2.1. Isolation method of purple photosynthetic bacteria

Water samples were collected in shrimp ponds in Truong Dinh Village, Hoa Lien Commune, Hoa Vang District, Da Nang City, and Hiep Hai Village, Binh Hung Commune, Thang Binh District, Quang Nam Province. The samples were enriched by cultured in glass flasks of 100 ml volume. Wastewater samples were put into bottles at a ratio of 1:1. Then these flasks were filled with DSMZ-27 medium, in non-aerated conditions, under natural light, at a temperature between 28–30 °C, pH from 6.5–7.5. After about a week, colored lines from yellow-brown to burgundy appeared on the jar's walls (representing the presence of pigment characteristic of photosynthetic purple bacteria). Sampling from the colored stripe and then isolated on a petri dish containing DSMZ 27 agar. After about 3–5 days, round brown, pink, and purple colonies appeared. These colonies were cleaned by the streak plate method and incubated under light conditions (Do Thi Lien, 2016).

2.2. Research method of cell morphology, physiological and biochemical characteristics of isolates

After seven days of culture on DSMZ — 27 medium, bacterial colonies were observed under the microscope to record the shape, size, and color of colonies. Carrying out Gram staining, testing the ability to ferment sugar, catalase, degradation of Urea, and Citrate (Bergey's, 1989).

2.3. Identification method of bacterial by molecular biology techniques

Checking isolated Rhdobacter sp. by PCR (Polymerase Chain Reaction)

Primer sequences were used to amplify the 16S rRNA gene region

Primer

Sequences

27F

5’- AGAGTTTGATCCTGGCTCAG — 3’

1492R

5’ — GGTTACCTTGTTACGACTT — 3’

PCR products after amplification were sequenced using automated sequencing. After sequencing the 16S rRNA gene, compare the sequence with GenBank published in the NCBI data bank using the BLAST tool to identify the purple photosynthetic bacteria on the similarity of the 16S rRNA gene sequence with the sequences available on the database.

2.4. Survey method for some factors affecting the growth ability of identified bacterial

a) Effect of pH: Prepare the growth medium DSMZ-27 in 100 ml/L cylindrical glass bottles to survey the pH range 4; 4.5; 5; 5.5; 6; 6.5; 7; 7.5; 8; 8.5; 9.

b) Effect of salt concentration : Prepare the DSMZ-27 medium; the selected strains are grown in 300 ml cylindrical glass flasks, and the salt concentration is investigated in the 0‰ range; ten‰; 15‰; 20‰; 25‰; 30‰; 35‰ and the pH was selected in ''a'' item.

The experiment was conducted under lighting conditions, and record the results after seven days.

2.5. Method of building the growth curve of the identified purple photosynthetic bacteria

Construct a correlation curve between OD and log cell density (CFU/ml)

The 7-day culture broth was diluted in DSZM-27 medium to obtain OD660 nm concentrations of 0.1; 0.2; 0.3; 0.4; 0.5; 0.6, respectively. Then proceed to dilute to 10–8 and inoculate on a plate of DSMZ-27 agar at a concentration of 10–6; 10–7; 10–8.

Build growth curve: Measure the OD value every 12 hours from the culture broth using a Jasco V750 spectrometer. Based on the results of the OD value and the correlation equation to build the growth curve.

2.6. Method to evaluate the efficiency of organic compounds treatment of the identified purple photosynthetic bacteria

Create a hypothetical wastewater environment by adding glucose to have organic concentrations of 10, 50, 100, 200, and 400 mgC/, respectively.

The experiment used 30 cylinders with a volume of 300 ml, added to each flask 2 % bacterial solution obtained from section 2.2.6 with pH and salinity determined in section 2.2.8, adding organic matter content is: 10, 50, 100, 200, and 400 mgC/L, respectively.

Controlled experiment: the environment has salinity and pH determined in item 2.2.8 with organic matter content of 10, 50, 100, 200, and 400 mgC/L, respectively, but without adding Rhodobacter.

The density of Rhodobacter was determined through the cell suspension absorbance on the spectrophotometer. The organic matter content was monitored daily through the permanganate method's COD indicator (QCVN 6186–1996).

2.7. Data processing methods

The experiments were repeated three times. The results are calculated and processed by statistics on MS programs — Excel and Rstudio.

3. Research results and discussion

3.1. Isolation of Rhodobacter sp. from shrimp wastewater samples

From water samples collected in Truong Dinh Village, Hoa Lien Commune, Hoa Vang District, Da Nang City, and in Hiep Hung Village, Binh Hai Commune, Thang Binh District, Quang Nam Province, four strains of bacteria were isolated. Symboled bacteria (RH01 → RH04) could grow in liquid DSMZ — 27 medium (Table 1, Figure 1). The two strains of RH02 have round, convex, glossy, spherical, chain-forming cells, are positive for sugars, citrate, and urea, are negative for catalase, and are gram-negative bacteria, which is consistent with the described characteristics of Rhodobacter sp. according to Bergey's taxonomy and studies by other scientists on this bacterium (Bergey's, 1989; Brenner et al., 2005; Weaver et al., 1975).

Table 1

Colony morphology characteristics of 4 isolated bacteria

Name

RH01

RH02

RH03

RH04

Colony characteristics

Color

Dark Pink, Diameter 3,3µm

Light pink, Diameter 3,1 µm

Light pink, Diameter 2,6µm

Light pink, Diameter 1.9µm

Morphology

Round, wet, convex surface, slimy

Round, convex surface, glossy

Round, convex surface, flat edge

Round, flat surface, inner edge

Cell characteristics

Shape

Egg-shaped

Spherical

Egg-shaped

Egg-shaped

Gram

-

-

-

-

Biochemical characteristics

Glucose

-

+

-

-

Frutose

-

+

-

-

Mantose

-

+

-

-

Catalaste

+

-

+

+

Urea

-

-

+

+

Citrat

-

+

-

+

Note: (+) positive (-) negative

Fig. 1. Colony shapes of 4 strains isolated from wastewater samples

3.2. Identification of rh02 bacterial by molecular biology techniques

RH02 bacteria were identified using molecular biology techniques. The results of reading 16s — rRNA sequences were compared to the NCBI gene bank to identify RH02 species. RH02 bacteria has a sequence of 16s — rRNA gene region, which is 97.70 % similar to Rhodobacter capsulatus species (Figure 2)- allowing the conclusion that RH02 bacteria is a species of Rhodobacter capsulatus.

Fig. 2. Searching for homology sequence of Rhodobacter

3.3. Investigate some factors affecting the growth and development of Rhodobacter capsulatus

3.3.1. pH effects

The results of the investigation of pH affection on the growth and development of Rhodobacter capsulatus are shown in Figures 3 and 4.

Fig. 3. Growth rate of Rhodobacter capsulatus under light conditions

Fig. 4. Growth rate of Rhodobacter capsulatus under shading conditions

The results show that the bacterial strain can grow quite well in the pH range of 6–7.5 in both light and dark conditions. Besides, under pH conditions in which less than five microorganisms are inhibited and have a prolonged growth rate and under light conditions, the results are more optimistic than in dark conditions. The experimental results are consistent with domestic and international studies (Brenner et al., 2005; Do Thi Lien, 2016).

Under light conditions, the growth rate of Rhodobacter capsulatus was faster than in the dark states. The growth rate was maximum at 0.08 with a cell density of 15x108; in dark conditions, the growth rate was packed at 0.08 with a cell density of 15x108 and peaked at only 0.05 with a cell density of 12x108. Rhodobacter capsulatus is a microorganism that can conduct photosynthesis to collect and receive energy to serve the living activities of the cell (CA, 1982). Therefore, growth and development are faster in light conditions than in dark conditions.

To apply the isolated Rhodobacter capsulatus strain to test the ability to treat organic compounds in water, pH = 7 was selected.

3.3.2.Salinity effects

The survey results in Figures 5 and 6 show that the Rhodobacter capsulatus strain can adapt to an environment with salinity up to 35 ‰. Still, at 25 salinity, the growth rate is the best.

Besides, when comparing the growth rate with light and dark conditions, it was found that this bacterial strain grew better in lighting conditions nine times.

Fig. 5. The growth rate of Rhodobacter capsulatus (NaCl was added to determine the concentration 0‰; 10‰; 15‰; 20‰; 25‰; 30‰; 35‰, under light conditions) C

Fig. 6. The growth rate of Rhodobacter capsulatus (NaCl was added to determine the concentration 0‰; 10‰; 15‰; 20‰; 25‰; 30‰; 35‰, under shading conditions)

The results above showed that the Rhodobacter capsulatus bacteria isolated from shrimp wastewater is salt tolerant. This research result is consistent with the study of Bergey and Tra, 2015; Brenner et al., 2005).

3.4. Survey on the growth curve of the Rhodobacter capsulatus

The growth and development of Rhodobacter capsulatus are shown by the growth curve and growth rate. The results are presented in Figure 7.

Fig. 7 Growth rate of Rhodobacter capsulatus

The results showed that Rhodobacter capsulatus had a latent phase lasting about 36h. The exponential phase lasted 24 to 36 hours, corresponding to a maximum growth rate of 0.04 at 72h of culture (15x10 8 CFU/ml). However, as the culture time continues to be prolonged, the cell density gradually decreases and begins to decline due to the depletion of nutrients in the medium; the competition for nutrients by bacteria takes place, together with the products of metabolism inhibiting the growth of bacteria, the number of cells produced is less than the number of cells lost (Costa et al., 2017).

3.5 . Evaluating the efficiency of organic compounds processing ability of Rhodobacter capsulatus.

To evaluate the ability of organic matter treatment of the Rhodobacter capsulatus , an experiment was carried out to grow this strain on wastewater with the assumption of adding glucose to the carbon content of 10 mg/L; 50 mg/L; 100 mg/L; 200 mg/L; 400 mg/L, with salinity 25‰ and pH=7. The experiment was conducted under lighting conditions of 3000 lux. Their biomass accumulation and organic matter treatment were monitored for seven days. The results are shown in Figure 8, Figure 9, and Table 2.

Fig. 8. Growth ability of Rhodobacter capsulatus after seven days

The results from Figure 9 show that the isolated Rhodobacter capsulatus could grow at almost all carbon concentrations from 10 mg — 400 mg/L. The content 50mg/L, 100mg/L, 200mg/L, and 400mg/L had better growth rates and ability than those at 10mg/L concentration. The ability to accumulate biomass at concentrations of 50; 100; 200; 400mg/L gave similar results, and both peaked at day 4 with a density of ~ 15x108 (CFU/ml). Meanwhile, at the concentration of 10mg/L, the growth rate was lower; the highest density was only 12x10 8 (CFU/ml) on day 4.

Table 2

V ariation of organic matter content and treatment efficiency after seven days of testing

Carbon content

Bacterial

Non-bacterial

COD content on Day 0

COD content on Day 7

Carbon removal efficiency (%)

COD content on Day 0

COD content on Day 7

Carbon removal efficiency (%)

10 mg/L

65

36

45 %

65

50

16.60 %

50 mg/L

176

25

85.80 %

176

126

28.40 %

100 mg/L

315

40

87.30 %

315

280

11.10 %

200 mg/L

700

76

89 %

700

650

7.14 %

400 mg/L

1426

219

84.60 %

1426

1024

28.10 %

Fig. 9. The ability of Rhobacter capsulatus to remove COD after seven days

The results from Tables 2 and 9 show that Rhodobacter capsulatus can process organic compounds at relatively high concentrations. In the survey treatments, the ability to treat the best results at concentrations of 50; 100; 200; 400 mg/L has an efficiency of 80–85 %, while at a low concentration of 10 mg/L, the treatment efficiency is only 45 %, through that the higher the organic matter content, the higher the growth and treatment efficiency of the strain. It shows that the isolated Rhodobacter capsulatus bacteria can decompose organic substances and use them as a source of substrates for their life activities. This result is entirely consistent with My Tran Huong Tra et al. and the study of Costa et al. (Tra et al., 2015; Costa et al., 2017).

4. Results

Isolation and identification of an RH02 bacteria ( Rhodobacter capsulatus ) from wastewater samples from shrimp ponds in Hiep Hung Village, Binh Hai Commune, Thang Binh District, Quang Nam Province. Determining the optimal culture conditions for this strain are DSMZ — 27 medium at 28 -300C, pH = 7, salinity 25‰, and biomass collection time after 72h of culture. Investigated the ability to process organic compounds of the Rhodobacter capsulatus and found that after seven days of testing, the bacteria could process organic compounds at concentrations of 50; 100; 200; 400 mg/L with an efficiency of 80–85 %.

References:

  1. Bergey’s. (2001). Mycoplasma. In Infectious Diseases in Obstetrics and Gynecology, Sixth Edition.
  2. Brenner, D. J., Krieg, R., Staley, J. T., & Garrity, G. M. (2005). Manual® of Systematic Bacteriology: Volume Two The Proteobacteria Part C The Alpha-, Beta-, Delta-, and Epsilonproteobacteria. In Bergey’s Manual of Bacterial Systematics (Vol. 2, Issue 2).
  3. CA, W. (1982). Dynamics of photosynthetic membrane composition and function. Wraight CA (1982) Current Researchs on Photosynthesis, In Godvindjee (Ed), Photosynthesis, Vol.I, Academic Press. New York, London., 1058(2), 87–106.
  4. Costa, S., Ganzerli, S., Rugiero, I., Pellizzari, S., Pedrini, P., & Tamburini, E. (2017). Potential of Rhodobacter capsulatus grown in anaerobic-light or aerobic-dark conditions as bioremediation agent for biological wastewater treatments. Water (Switzerland), 9(2).
  5. Do Thi Lien. (2016). Research on the application of purple photosynthetic bacteria to treat Sulfide in polluted water sources. 1–25.
  6. N., Kantachote D., Chaiprapat. S. (2014). Use of Rhodopseudomonas palustris P1 stimulated growth by fermented pineapple extract to treat latex rubber sheet wastewater to obtain single cell protein. Annals of Microbiology, 64, 1021–1032.
  7. Tra, M. T. H. (2015). Research on the culture and use of Rhodobacteria to treat organic matter and sulfide in polluted water on a laboratory scale
  8. Research Institute for Aquaculture N 1 (2013). Project: Controlling environmental pollution in aquaculture (Shrimp, Pangasius) until 2020. 2020, 36.
  9. Wang, J., Nie, X., Zhang, L., & Zhao, Z. (2016). Optimization of production procedures for coenzyme Q 10 from Rhodobacter sphaeroides. 8(7), 924–929.
  10. Weaver, P. F., Wall, J. D., & Gest, H. (1975). Characterization of Rhodopseudomonas capsulata. Archives of Microbiology, 105(1), 207–216.
Основные термины (генерируются автоматически): COD, DSMZ, CFU, NCBI, PCR, AGAGTTTGATCCTGGCTCAG, BLAST, GGTTACCTTGTTACGACTT, QCVN, USD.


Ключевые слова

non-sulfur purple bacteria, shrimp farming, waste water, nitrogen, Rhodobacter capsulatus

Похожие статьи

Isolation and identification of factors affecting antimicrobial compound production of Bacillus velezensis

From 30 soil samples taken from many different areas of Da Nang city. We have collected 7 strains of bacteria capable of producing strong antibacterial compounds with E.coli, Salmonella, and B.cereus. In which, V7 strain is the strongest antibiotic p...

Studies on antibacterial and antifungal of ethanol extract from wedelia chinensis in Viet Nam

This study examined the in vitro antibacterial and antifungal activities of ethanol extracts from Wedelia chinensis. The extracts were tested against two E. coli and Slamonella and two strains fungi A. flavus và F. solani (using disc diffusion method...

Investigation of infuential factors on the pigment — producing fungus monascus purpureus

The goal of the study was to ascertain the optimal conditions for Monascus purpureus to produce pigments through biosynthesis. Peptone, glucose, a C/N ratio of 8, pH values of 4 for yellow pigment and pH values of 5.5 for red pigment were found to be...

Use of Moringa oleifera seeds as natural coagulant for water purification in Viet Nam

This study was carried out to confirm the effectiveness of powder extracted from mature dried Moringa oleifera (M. oleifera) seeds which is commonly available in most rural communities of Viet Nam in drinking water treatment. The optimal dose of M. o...

Bioremoval capacity of arsenic from contaminated water by using Chlorella vulgaris

Microalgae have been recognized as a metal biosorption which can apply to treat industrial wastewater. The study proved microalgae Chlorella vulgaris (C. vulgaris) as biosorbent for As removal from aqueous solution. The effects of operational conditi...

Synthesis and study of the ability of silver nanoparticles against the pathogen Fusarium Oxysporum on Chrysanthemum Indicum

To overcome and minimize the number of pesticides, this study presents safe biological nano-emulsions from silver nanoparticles, neem oil, and polyhexamethylene biguanide (PHMB) with nanoparticle sizes ranging from 42 to 78 nm, inhibiting Fusarium ox...

Groundwater nitrate contamination and its potential health effects

Mineral anions are one of the most important toxic substances that are harmful to humans and animals even in low concentrations. Contamination of groundwater and rural drinking water by nitrates from livestock, human waste, other organic wastes or ch...

Composition of the source of fish seed exploited at the Thu bon estuary, Quang Nam province

This paper presents the survey results on fish seed sources exploited at Thu Bon estuary, Quang Nam Province (VietNam) through 12 researches were conducted from May 5, 2017–12/2017 in different types of gear fishing: push net, filter net, light finde...

Selection of Trichoderma sp. against Meloidogyne spp. causing disease on pepper tree

Piper nigrum is long — term industrial tree with high economic value but very sensitive to pathogens, especially Meloidogyne spp. We want to select the strains of Trichoderma sp. to control harmful nematodes on Piper nigrum. From 30 acres of pepper l...

The Evaluation of Vitamin A & Bet-Carotene Levels during Postpartum Period in Semi Industrial Dairy Farms in Iran

Vitamin A, retinol, plays a vital role in vision sense. Due to the presence of large amounts of beta-carotene in cattle's foods & vitamin A stores in liver, the hypovitaminosis is not probable. Increased secretion of vitamin A in milk during postpart...

Похожие статьи

Isolation and identification of factors affecting antimicrobial compound production of Bacillus velezensis

From 30 soil samples taken from many different areas of Da Nang city. We have collected 7 strains of bacteria capable of producing strong antibacterial compounds with E.coli, Salmonella, and B.cereus. In which, V7 strain is the strongest antibiotic p...

Studies on antibacterial and antifungal of ethanol extract from wedelia chinensis in Viet Nam

This study examined the in vitro antibacterial and antifungal activities of ethanol extracts from Wedelia chinensis. The extracts were tested against two E. coli and Slamonella and two strains fungi A. flavus và F. solani (using disc diffusion method...

Investigation of infuential factors on the pigment — producing fungus monascus purpureus

The goal of the study was to ascertain the optimal conditions for Monascus purpureus to produce pigments through biosynthesis. Peptone, glucose, a C/N ratio of 8, pH values of 4 for yellow pigment and pH values of 5.5 for red pigment were found to be...

Use of Moringa oleifera seeds as natural coagulant for water purification in Viet Nam

This study was carried out to confirm the effectiveness of powder extracted from mature dried Moringa oleifera (M. oleifera) seeds which is commonly available in most rural communities of Viet Nam in drinking water treatment. The optimal dose of M. o...

Bioremoval capacity of arsenic from contaminated water by using Chlorella vulgaris

Microalgae have been recognized as a metal biosorption which can apply to treat industrial wastewater. The study proved microalgae Chlorella vulgaris (C. vulgaris) as biosorbent for As removal from aqueous solution. The effects of operational conditi...

Synthesis and study of the ability of silver nanoparticles against the pathogen Fusarium Oxysporum on Chrysanthemum Indicum

To overcome and minimize the number of pesticides, this study presents safe biological nano-emulsions from silver nanoparticles, neem oil, and polyhexamethylene biguanide (PHMB) with nanoparticle sizes ranging from 42 to 78 nm, inhibiting Fusarium ox...

Groundwater nitrate contamination and its potential health effects

Mineral anions are one of the most important toxic substances that are harmful to humans and animals even in low concentrations. Contamination of groundwater and rural drinking water by nitrates from livestock, human waste, other organic wastes or ch...

Composition of the source of fish seed exploited at the Thu bon estuary, Quang Nam province

This paper presents the survey results on fish seed sources exploited at Thu Bon estuary, Quang Nam Province (VietNam) through 12 researches were conducted from May 5, 2017–12/2017 in different types of gear fishing: push net, filter net, light finde...

Selection of Trichoderma sp. against Meloidogyne spp. causing disease on pepper tree

Piper nigrum is long — term industrial tree with high economic value but very sensitive to pathogens, especially Meloidogyne spp. We want to select the strains of Trichoderma sp. to control harmful nematodes on Piper nigrum. From 30 acres of pepper l...

The Evaluation of Vitamin A & Bet-Carotene Levels during Postpartum Period in Semi Industrial Dairy Farms in Iran

Vitamin A, retinol, plays a vital role in vision sense. Due to the presence of large amounts of beta-carotene in cattle's foods & vitamin A stores in liver, the hypovitaminosis is not probable. Increased secretion of vitamin A in milk during postpart...

Задать вопрос